# UP-TORR Documentation ## expand\_more ## URL ## Video Tutorial ## Input Form ![UP-TORR input form](/sites/g/files/omnuum5366/files/fly/files/up-torr_input_form.png) ### UP-TORR search options Note: Maximum rows of search input:500. For a report of all reagents, use the "All-Reagent On-Target" and "All-Reagent Off-Target" download options on the Fly and Worm pages. **Option 1**: Enter the sequence(s) of RNAi reagent(s) You need to select the species first and then enter RNAi sequence with ID. For example: 1. GCGGCGGTTAACAATACCGAA 2. GCGGCGGTTAACAATACCGAA 3. GCGGCGGTTAACAATACCGAA 4. TTTTTGTTTGTTTTACTCCGA 5. CTGGTTATACCAGGACATTGA The 1 st column is user-specificied RNAi reagent ID and the 2nd column is the gene-specific sequence of RNAi reagent. **Option 2:** Enter the primer sequences for dsRNA reagent(s) You need to select the species first and then enter primer-pair sequence with ID. For example: 1 ATCTGCTGCTGCAGGTTC GCCAACTATCAGTTCCCAAC 2 CTCATCATTTATAAGATGGTCAC AAATGAAAAACAAGTTCAAACTG 3 TTTCTTTGTCCTCCTTATTCTTC GAACCCGCCACCCTATGA 4 ATATGTGGGCTATAGCGAAAT CAGAACACGGCCGACAC 5 GTTTTTTTTCCCCTCCATCTTT GAGTGGGCAAAGTACAAGAT 6 GACGCTGCTTATCTTCCTGG CTTGGTCTTCTTGCCAAAGC The 1 st column is user-specified RNAi reagent ID. The 2nd column is the gene-specific sequence of first PCR primer. The 3rd column is the gene-specific sequence of second PCR primer. **Option 3:** Enter RNAi reagent ID(s) from the following resources. - DRSC amplicon (DRSC amplicon ID) - DKFZ amplicon (BKN amplicon ID) - TRiP transgenic fly (stock ID or hairpin ID) - NIG transgenic fly (stock ID) - VDRC transgenic fly (transformant ID) For example: - JF02592 - DRSC32366 - DRSC32367 - HMS00794 - JF01257 - 30044R-1 - BKN20541 **Option 4:** Enter gene identifier(s) to query the available fly RNAi reagents such as FlyBase gene identifier and gene symbol. For example: - wg - s-cup - RpL27 - FBgn0003996 - CG10006 **Option 5:** Enter sequence(s) and query all the fly RNAi reagents that target these sequence(s) For example: >wg exon2 GGGCATTGCCAAGGTCGGCGAACCCAACAACATTACGCCCATCATGTACA TGGACCCAGCGATCCACTCTACGTTGAGAAGGAAACAGCGACGCCTGGTC AGGGACAATCCCGGTGTACTGGGAGCCCTGGTCAAGGGCGCCAACTTGGC CATTAGCGAGTGCCAACACCAGTTCAGAAATCGCCGCTGGAAC TGCTCGA CGAGAAACTTCTCGAGGGGCAAAAATCTATTCGGCAAAATCGTTGATCGA G